View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10426_high_14 (Length: 230)

Name: NF10426_high_14
Description: NF10426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10426_high_14
NF10426_high_14
[»] chr8 (1 HSPs)
chr8 (150-220)||(11419547-11419617)


Alignment Details
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 11419547 - 11419617
Alignment:
150 tactctatcacatgttaataattatgcattctggcattaacaattattttctatacaatctggttcctttg 220  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
11419547 tactctatcacatgttaataattatgcattttggcattaacaattattttctatagaatctggttcctttg 11419617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University