View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10426_low_1 (Length: 443)
Name: NF10426_low_1
Description: NF10426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10426_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 369 - 424
Target Start/End: Original strand, 31680550 - 31680605
Alignment:
| Q |
369 |
gttgatcctcttttccatttcttcacttctccaacatcatgtcaaacgactccgtt |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31680550 |
gttgatcctcttttccatttcttcacttctccaacatcatgtcaaacgacgccgtt |
31680605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 31680475 - 31680531
Alignment:
| Q |
1 |
atttaagtgaaacctatagttcctaagaggatcattgactcaaaattacatcggact |
57 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31680475 |
atttaagtgaaacctacggttcctaaaaggatcattgactcaaaattacatcggact |
31680531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University