View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10426_low_16 (Length: 230)
Name: NF10426_low_16
Description: NF10426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10426_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 11419547 - 11419617
Alignment:
| Q |
150 |
tactctatcacatgttaataattatgcattctggcattaacaattattttctatacaatctggttcctttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11419547 |
tactctatcacatgttaataattatgcattttggcattaacaattattttctatagaatctggttcctttg |
11419617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University