View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10426_low_17 (Length: 227)
Name: NF10426_low_17
Description: NF10426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10426_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 8336195 - 8336306
Alignment:
| Q |
1 |
gtaatagttgtgtttggagatatatgtttaggcaaataatatttacaaaggtagtaaataaaatgaagttaactcatttaaataaacgtgaataaattgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8336195 |
gtaatagttgtgtttggagatatatgtttgggcaaataatatttacaaaggtagtaaataaaatgaagttaactcatttaaataaacatgaataaattgt |
8336294 |
T |
 |
| Q |
101 |
tgttctataata |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8336295 |
tgttctataata |
8336306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University