View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10427_high_14 (Length: 252)
Name: NF10427_high_14
Description: NF10427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10427_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 127 - 234
Target Start/End: Complemental strand, 30805725 - 30805618
Alignment:
| Q |
127 |
gatcatgaaacagttctgttccgacagtgttttgtactaggttttgggtaaaactaggttacttttgaaggacttggatttgcatgtactagggttttgg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805725 |
gatcatgaaacagttctgttccgacagtgttttgtactaggttttgggtaaaactaggttacttttgaaggacttggatttgcatgtactagggttttgg |
30805626 |
T |
|
| Q |
227 |
gtaaaact |
234 |
Q |
| |
|
|||||||| |
|
|
| T |
30805625 |
gtaaaact |
30805618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 65
Target Start/End: Complemental strand, 30805840 - 30805788
Alignment:
| Q |
13 |
gagatgaatacggcgtgcgtggaatgagatgtttctaagaagaatagaagtca |
65 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805840 |
gagacgaatacggcgtgcgtggaatgagatgtttctaagaagaatagaagtca |
30805788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 30805633 - 30805587
Alignment:
| Q |
166 |
ggttttgggtaaaactaggttacttttgaaggacttggatttgcatg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
30805633 |
ggttttgggtaaaactatgttacttttcaaggacttggatttgcatg |
30805587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University