View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10427_high_16 (Length: 248)
Name: NF10427_high_16
Description: NF10427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10427_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 39 - 238
Target Start/End: Complemental strand, 14152356 - 14152157
Alignment:
| Q |
39 |
aagttaggatttgcagaatatatcagaattctattgcaaagaatttcacaatacaaaaaatatttgtcaagtttttatcactgttgcaaagattttcaga |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14152356 |
aagttaggatttgcagaatatatcagaattctattgcaaagaatttcacaatacaaaaaatatttgtcatgtttttatcactgttgcaaagattttcaga |
14152257 |
T |
 |
| Q |
139 |
atgtgcatttcatttcattataaataggtctaattgtacttttgcaccctcaagtattacgattttcgtcttccttcaaacgagtgtgacttttcttcat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14152256 |
atgtgcatttcatttcattataaataggtctaagtgtacttttgcaccctcaagtattacgattttcgtcttccttcaaacgagtgtgacttttcttcat |
14152157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University