View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10427_low_19 (Length: 248)

Name: NF10427_low_19
Description: NF10427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10427_low_19
NF10427_low_19
[»] chr8 (1 HSPs)
chr8 (39-238)||(14152157-14152356)


Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 39 - 238
Target Start/End: Complemental strand, 14152356 - 14152157
Alignment:
39 aagttaggatttgcagaatatatcagaattctattgcaaagaatttcacaatacaaaaaatatttgtcaagtttttatcactgttgcaaagattttcaga 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
14152356 aagttaggatttgcagaatatatcagaattctattgcaaagaatttcacaatacaaaaaatatttgtcatgtttttatcactgttgcaaagattttcaga 14152257  T
139 atgtgcatttcatttcattataaataggtctaattgtacttttgcaccctcaagtattacgattttcgtcttccttcaaacgagtgtgacttttcttcat 238  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14152256 atgtgcatttcatttcattataaataggtctaagtgtacttttgcaccctcaagtattacgattttcgtcttccttcaaacgagtgtgacttttcttcat 14152157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University