View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10427_low_20 (Length: 240)
Name: NF10427_low_20
Description: NF10427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10427_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 3642238 - 3642035
Alignment:
| Q |
20 |
gaaagtagagatttcatacacacaagtaaagagtggtatactaatttacttataaaagtattcaaaggtttctctctctttttaaaattnnnnnnntcaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||| |
|
|
| T |
3642238 |
gaaagtagagatttcatacacacaagtaaagagtggtatactaatttacttataaaagtattcaaaggtttctctctttttttaaaaataaaaaaatcaa |
3642139 |
T |
|
| Q |
120 |
ttaagctgcaaacttgatcagaattacagttccagttggattaattatttatttattaaacttactaatgattggctaaatatattttgaaccaataata |
219 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
3642138 |
ttaagctgcaaacttgatcataattacagttccagttggattaattatttatttattaaacttaccaatgattggcttaatatattttgaaccaataata |
3642039 |
T |
|
| Q |
220 |
aatg |
223 |
Q |
| |
|
|||| |
|
|
| T |
3642038 |
aatg |
3642035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University