View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10427_low_23 (Length: 201)
Name: NF10427_low_23
Description: NF10427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10427_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 182
Target Start/End: Original strand, 47579519 - 47579686
Alignment:
| Q |
15 |
aaggtgattcagagtacgttgtttgtttccggactaagcacgtttcttcaatctttattcggaacccgattgccaagtgtagttgttggttcatacactt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47579519 |
aaggtgattcagagtacgttgtttgtttctggactgagcacgtttcttcaatctttattcggaacccgattgccaagtgtagttgttggttcatacactt |
47579618 |
T |
 |
| Q |
115 |
acatgataccaattatgtcagctgttcaagctagcagatacagttcatatacagatccttatgaggtt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47579619 |
acatgataccaattatgtcagctgttcaagctagcagatacagttcatatacagatccttatgaggtt |
47579686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 36 - 181
Target Start/End: Original strand, 8683237 - 8683382
Alignment:
| Q |
36 |
tttgtttccggactaagcacgtttcttcaatctttattcggaacccgattgccaagtgtagttgttggttcatacacttacatgataccaattatgtcag |
135 |
Q |
| |
|
||||| || ||||||||||| ||| |||||||||| |||||||| |||||||||| |||| ||||||||||||||| |||||| ||||| || || || |
|
|
| T |
8683237 |
tttgtgtctggactaagcacattttttcaatctttgttcggaactcgattgccaattgtaattgttggttcatacagttacataatacctataatttcta |
8683336 |
T |
 |
| Q |
136 |
ctgttcaagctagcagatacagttcatatacagatccttatgaggt |
181 |
Q |
| |
|
|||||| ||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
8683337 |
ttgttcaggctagcagatataatgcatatacagatccttatgaggt |
8683382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University