View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10427_low_6 (Length: 450)
Name: NF10427_low_6
Description: NF10427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10427_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 434; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 434; E-Value: 0
Query Start/End: Original strand, 1 - 434
Target Start/End: Complemental strand, 55967 - 55534
Alignment:
| Q |
1 |
tggacaaggcttgtgtccaagaggccgggaacaacacaaaggaaagcccgtggagattgtgtagtgttgcacaagttgaacaagcaaagatattactttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55967 |
tggacaaggcttgtgtccaagaggccgggaacaacacaaaggaaagcccgtggagattgtgtagtgttgcacaagttgaacaagcaaagatattactttc |
55868 |
T |
|
| Q |
101 |
ggttattccaatttttgcatgcactataattttcaacactatcttagcacaacttcaaacattctcggtccagcaaggaagtgccatggacacacatgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55867 |
ggttattccaatttttgcatgcactataattttcaacactatcttagcacaacttcaaacattctcggtccagcaaggaagtgccatggacacacatgtc |
55768 |
T |
|
| Q |
201 |
acaaaatcatttcatatccctccagcatcacttcagtcaattccttacatttttctcatcgttgtagtccctctctatgatactttatttgttccctttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55767 |
acaaaatcatttcatatccctccagcatcacttcagtcaattccttacatttttctcatcgttgtagtccctctctatgatactttatttgttccctttg |
55668 |
T |
|
| Q |
301 |
caagaaaaataacaggtcatgagtcaggaatctcacctttgcagagaatagggattggcctttttctggctacattttctatggtttcagcagctgttat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55667 |
caagaaaaataacaggtcatgagtcaggaatctcacctttgcagagaatagggattggcctttttctggctacattttctatggtttcagcagctgttat |
55568 |
T |
|
| Q |
401 |
ggagaaaaagagaagggatgcagctgtgaacctg |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
55567 |
ggagaaaaagagaagggatgcagctgtgaacctg |
55534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University