View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10427_low_8 (Length: 417)
Name: NF10427_low_8
Description: NF10427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10427_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 27 - 285
Target Start/End: Original strand, 6453995 - 6454254
Alignment:
| Q |
27 |
ccctttttcactaacttttcgctcaaaccaccatccccnnnnnnnctctgatcttttctctttctcttcatttaatcttttttcctttatnnnnnnntct |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6453995 |
ccctttttcactaacttttcgctcaaaccaccatccccaaaaaaactctgatcttttctctttctcttcatttaatcttttttcctttataaaaaa-tct |
6454093 |
T |
 |
| Q |
127 |
ctatctctgactaagttactagta-gtctctggaaaaattaattcatctctgtgttatattaaaa-aatgcaattctttaaatcaaccctagttggatcc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6454094 |
ctatctctgactaagttactagtaagtctctggaaaaattaattcatctctgtgttatattaaaaaaatgcaattctttaaatcaaccctagttggatcc |
6454193 |
T |
 |
| Q |
225 |
tactaaaagggtacctcgaaaacaatgcaaatcatgactcactcatgatcatataatcact |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454194 |
tactaaaagggtacctcgaaaacaatgcaaatcatgactcactcatgatcatataatcact |
6454254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 345 - 407
Target Start/End: Original strand, 6454314 - 6454376
Alignment:
| Q |
345 |
agtactctatactataccctaattaaatcacatcctaaaatgcatactttattttcacctttg |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454314 |
agtactctatactataccctaattaaatcacatcctaaaatgcatactttattttcacctttg |
6454376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University