View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10427_low_9 (Length: 404)
Name: NF10427_low_9
Description: NF10427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10427_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 258
Target Start/End: Complemental strand, 15610682 - 15610428
Alignment:
| Q |
14 |
cagagatcaattttaacctatgtaagaaactagttttaaaagctaaactgtcactctcagtgacattgtgaaaccaaagaaagaaaaagctaaggaaagt |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15610682 |
cagaaatcaattttaacctatgtaagaaattagttttaaaagctaaactgtcactctcagtgacattgtgaaaccaaagaaagaaaaagctaaggaaagt |
15610583 |
T |
|
| Q |
114 |
tttctattttcaaagggcaagttaattttcagtgcaaaaatgtcact----------ggaattctctagttgttgcaacctctcatcttcaatgatttat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15610582 |
tttctattttcaaagggcaagttaattttcagtgcaaaaatgtcactggaagccactggaattctctagttgttgcaacctctcatcttcagtgatttat |
15610483 |
T |
|
| Q |
204 |
aacttttcctcttgcgatcatgatcaggttacaacctataaaaacaacaaaattt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15610482 |
aacttttcctcttgcgatcatgatcaggttacaacctataaaaacaacaaaattt |
15610428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University