View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10428_high_12 (Length: 239)
Name: NF10428_high_12
Description: NF10428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10428_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 120 - 223
Target Start/End: Complemental strand, 52407365 - 52407262
Alignment:
| Q |
120 |
aaggataaccttaacattaccagcctctttaatggcatcgatgattttcacttgatcagcagcatgtgtgtgactgagtgcagatatgaccacgtctacc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52407365 |
aaggataaccttaacattaccagcctctttaatggcatggatgattttcaattgatcagcagcatgtgtgtgactgagtgcagatatgaccacgtctacc |
52407266 |
T |
 |
| Q |
220 |
tgct |
223 |
Q |
| |
|
|||| |
|
|
| T |
52407265 |
tgct |
52407262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 52407505 - 52407421
Alignment:
| Q |
1 |
ccctagaacaagccaaaatagatattcaaagatcttttttgtttgagaggaaatatttaaagtatgtaaattaagaatatagagt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52407505 |
ccctagaacaagccaaaatagatattcaaagattttttttgtttgagaggaaatatttaaagtatgtaaattaagaatatagagt |
52407421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 176
Target Start/End: Complemental strand, 52400537 - 52400487
Alignment:
| Q |
126 |
aaccttaacattaccagcctctttaatggcatcgatgattttcacttgatc |
176 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| |||| || ||||||||||| |
|
|
| T |
52400537 |
aaccttaacattaccagcctccttaattgcagcgataatcttcacttgatc |
52400487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University