View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10428_low_16 (Length: 250)
Name: NF10428_low_16
Description: NF10428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10428_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 52407489 - 52407728
Alignment:
| Q |
1 |
tttggcttgttctagggtgtgcttttccaaagacattgtttaaattgtttaaagaatctaaaaaactttgaatannnnnnnnnnnnnnnnagagattttt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52407489 |
tttggcttgttctagggtgtgcatttccaaagacattgtttaaattgtttaaagaatctaaaaaactttgaatatctcctctctctct--agagattttt |
52407586 |
T |
 |
| Q |
101 |
cccttcagaatttgggaacgacgtggatcgtgtccatgctgttgagccagcaaaatctgtatttgccgtgaaagcacaaattcgacgtatgattgaagct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52407587 |
cccttcagaatttgggaacgacgtggatcgtgtccatgctgttgagccagcaaaatctgtattctccgtgaaagcacaaattcgacgtatgattgaagct |
52407686 |
T |
 |
| Q |
201 |
gaaggcataccctatacatatgtatctaccaactcctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52407687 |
gaaggcataccctatacatatgtatctaccaactcctttgct |
52407728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 91 - 242
Target Start/End: Original strand, 52405070 - 52405221
Alignment:
| Q |
91 |
agagatttttcccttcagaatttgggaacgacgtggatcgtgtccatgctgttgagccagcaaaatctgtatttgccgtgaaagcacaaattcgacgtat |
190 |
Q |
| |
|
|||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || || ||||||||||||| ||||| | |||||| |||||||||| |
|
|
| T |
52405070 |
agagattttttccttcggaattcgggaatgacgttgatcgtgtccatgcggtagatccagcaaaatctgcatttgaagggaaagccagaattcgacgtgc |
52405169 |
T |
 |
| Q |
191 |
gattgaagctgaaggcataccctatacatatgtatctaccaactcctttgct |
242 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| |||| ||||| ||||||| |
|
|
| T |
52405170 |
tattgaagcggaaggcataccctacacatatgtgtctagcaactactttgct |
52405221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University