View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10428_low_20 (Length: 241)

Name: NF10428_low_20
Description: NF10428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10428_low_20
NF10428_low_20
[»] chr7 (1 HSPs)
chr7 (1-222)||(35155012-35155233)


Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 35155012 - 35155233
Alignment:
1 ttcaatgtgtttgatcaaaatggagatgggttcatatcgggggaggaattaagcgcggtgttatcttctttgggcttaaagcatggaaaaactttagaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35155012 ttcaatgtgtttgatcaaaatggagatgggttcatatcgggggaggaattaagcgcggtgttatcttctttgggcttaaagcatggaaaaactttagaag 35155111  T
101 attgcaaaaatatgatcaagaaagttgatgtggatggtgatggaatggttaacttcaaagaatttaagcaaatgatgaaggctggagcttttgctgctga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
35155112 attgcaaaaatatgatcaagaaagttgatgtggatggtgatggaatggttaacttcaaagaatttcagcaaatgatgaaggctggagcttttgctgctga 35155211  T
201 ttcattgagttgatgcatggta 222  Q
    ||||||||||||||||||||||    
35155212 ttcattgagttgatgcatggta 35155233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University