View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10428_low_23 (Length: 237)
Name: NF10428_low_23
Description: NF10428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10428_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 12 - 201
Target Start/End: Original strand, 30213609 - 30213795
Alignment:
| Q |
12 |
acaattttcaccaaagatctttatatcatcatggttgtgcttgttatcccgatctggtcgtatgatatgtactttgtatcctcttatttccagtattgga |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30213609 |
acaattttcaccaaagatcttcatatcatcacggttgtgcttgttattccgatctggttgtatgatatgtactttgtatcctcttatttctagtattgga |
30213708 |
T |
 |
| Q |
112 |
agnnnnnnnnnntaagatgatgaaattttgagtatgtttatgtcatttgatggttacgataaaataaagagatttagtgttttgactttt |
201 |
Q |
| |
|
|| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
30213709 |
agaaaaaaaa---aagataatgaaaatttgagtatgtttatgtcatttgatggttacgataaaataaggaaatttagtgttttgactttt |
30213795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 197 - 237
Target Start/End: Original strand, 30214189 - 30214229
Alignment:
| Q |
197 |
cttttaaaaaatacacaagtctctccctagcttaagacttt |
237 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30214189 |
cttttaaaaaatacacaagtctctcccaagcttaagacttt |
30214229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 142 - 179
Target Start/End: Complemental strand, 46897299 - 46897262
Alignment:
| Q |
142 |
agtatgtttatgtcatttgatggttacgataaaataaa |
179 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
46897299 |
agtatgtttatgtcatttgatggttacaatcaaataaa |
46897262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University