View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10428_low_25 (Length: 223)
Name: NF10428_low_25
Description: NF10428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10428_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 63 - 210
Target Start/End: Original strand, 1829549 - 1829696
Alignment:
| Q |
63 |
tgctttgatatgctcaaatatatgcttttcaaccatgtgttgtccagatttacacagatttattagatagactaatgatactgaggaagcatagtatcta |
162 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1829549 |
tgctttgatatggtcaaatatatgcttttcgaccatgtgttgtccaggtttacacagattaattagatagactaatgatactgaggaagcatagtatcta |
1829648 |
T |
|
| Q |
163 |
atttttggaagatatcgttactctttcagttcagtatactttcctttg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1829649 |
atttttggaagatatcgctactctttcagttcagtatactttcctttg |
1829696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 1814236 - 1814306
Alignment:
| Q |
18 |
gacttgtggttggttgttatcttttttataaactccnnnnnnnngtgctttgatatgctcaaatatatgct |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
1814236 |
gacttgtggttggttgttatcttttttataaactccttttttttgtgctttgatatgctcacttatatgct |
1814306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University