View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10428_low_27 (Length: 203)
Name: NF10428_low_27
Description: NF10428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10428_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 130
Target Start/End: Complemental strand, 31015746 - 31015634
Alignment:
| Q |
18 |
gttagtgtttgcctaaacttaaataaactagtatattaaaagtataaaacttcaagagttgaagctgcctacattttaaccataatttagcggtacaaat |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31015746 |
gttagtgtttgcctaaatttaaataaactagtatattaaaagtataaaacttcaagagttgaagctgcctacattttaaccataatttagcggtgcaaat |
31015647 |
T |
|
| Q |
118 |
atagatgatcaat |
130 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31015646 |
atagatgatcaat |
31015634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 159 - 197
Target Start/End: Complemental strand, 31015605 - 31015567
Alignment:
| Q |
159 |
tataagtttcatctcttcattttagtacttcttctctct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31015605 |
tataagtttcatctcttcattttagtacttcttttctct |
31015567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University