View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10429_high_11 (Length: 241)
Name: NF10429_high_11
Description: NF10429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10429_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 23 - 223
Target Start/End: Original strand, 6452827 - 6453028
Alignment:
| Q |
23 |
tatcataacaacaaaggcacaagaggcttttttgtcatatgataatactccaagtgtgtgcgtgtatattaccttgaaaattcttatgatttaaatataa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6452827 |
tatcataacaacaaaggcacaagaggcttttttgtcatatgatgatactccaagtgtgtgcgtgtatattaccttgaaaattcttatgatttaaatataa |
6452926 |
T |
|
| Q |
123 |
ataaataaatcatgacaaatattgggataaaattgtagtctctcttatttcaagcaggtggtatacaaccaatcatataacaccatccg-aaaggataaa |
221 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6452927 |
ataaataaatcaggacaaatattgggataaaattgtagtctctcttatttcaagcaggtggtatacaaccaatcatataacaccatccgaaaaggataaa |
6453026 |
T |
|
| Q |
222 |
ca |
223 |
Q |
| |
|
|| |
|
|
| T |
6453027 |
ca |
6453028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 68 - 146
Target Start/End: Original strand, 6463584 - 6463662
Alignment:
| Q |
68 |
tactccaagtgtgtgcgtgtatattaccttgaaaattcttatgatttaaatataaataaataaatcatgacaaatattg |
146 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||| |
|
|
| T |
6463584 |
tactccaagtgtgtgcgtatatattaccttgaaaattcttatgatttaaataaaaataaataaaccatgataaatattg |
6463662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 6463685 - 6463758
Alignment:
| Q |
139 |
aaatattgggataaaattgtagtctctcttatttcaagcaggtggtatacaaccaatcatataacaccatccgaaa |
214 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6463685 |
aaatattgagataaaattgtcgtctc--ttatttcaagcaggtggtatacaaccaatcatataacaccatccgaaa |
6463758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University