View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10429_high_15 (Length: 234)
Name: NF10429_high_15
Description: NF10429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10429_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 24 - 217
Target Start/End: Complemental strand, 51068145 - 51067952
Alignment:
| Q |
24 |
ttaagtgtcaagagaagtaattttataacnnnnnnntaattttatataattatatccaaacaaattgaagttgannnnnnnaataagtgatgtgcgatat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51068145 |
ttaagtgtcaagagaagtaattttataacaaaaaaataattttatataattatatccagacaaattgaagttgatttttttaataagtgatgtgcgatat |
51068046 |
T |
 |
| Q |
124 |
aaatttgtgacatgagccggccttcaaggagataagaaaaaccaatacaattatataagcttcgtttgaaatgatcacatgtacatgtgactta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51068045 |
aaatttgtgacatgagccggccttcaaggagataagaaaaaccaatgcaattatattagcttcgtttgaaatgatcacatgcacatgtgactta |
51067952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University