View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10429_high_19 (Length: 211)
Name: NF10429_high_19
Description: NF10429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10429_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 37307980 - 37308154
Alignment:
| Q |
1 |
aaaaacaaaactatcattctctaatcatgcatgttagcagggacggatctgtgtgaggctgggtgtggctgttgccgcaccagcacagcctatattttct |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
37307980 |
aaaaacaaaattatcattctctaatcatgcatgttagcagggacggatctgtgtgaggctg----------ttgccacaccagcacagcctatattttct |
37308069 |
T |
 |
| Q |
101 |
aatatatgtgttatatttcaatataagacaacatattaaatgttcgtctagtggcttggaggagttggacaaacctggatgtccc |
185 |
Q |
| |
|
||||||| | |||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37308070 |
aatatatatcttatatttcaatataagacaacgtattaaacgttcgtctagtggcttggaggagttgaacaaacctggatgtccc |
37308154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University