View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10429_high_7 (Length: 362)
Name: NF10429_high_7
Description: NF10429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10429_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 140 - 333
Target Start/End: Original strand, 37275764 - 37275956
Alignment:
| Q |
140 |
aaatatgaaatatttgaaaagattaaatgaataaatacttaaatagtcattgtaaggttgaatttggttgaaaagtgcatcacatgcttgttgaggtgga |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37275764 |
aaatatgaaatatttgaaaagattaaatgaataaatacttaaatagtcattgtaaggttgaatttggttgaaaagtgcatcacatgcttgttgaggtgga |
37275863 |
T |
|
| Q |
240 |
caaatggtagcaaagttttgtgaccctttttggttctctttctctttaagatggggctttttagattttggtgttggcaagtcatctatggatt |
333 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
37275864 |
caaatggtagcaatgttttgtgaccctttttggttctctttctctttaagat-ggcctttttagactttggtattggcaagtcatctatggatt |
37275956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 37275604 - 37275721
Alignment:
| Q |
1 |
ccctcacaaatacattaacttaacttaacagctgctatttttaatattatttatttattgggtcatgcactttttcaatctgtcttgttgccactgtgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37275604 |
ccctcacaaatacattaacttaacttaacagctgctatttttaatattatttatttattgggtcgtgcactttttcaatctgtcttgttgccactgtgat |
37275703 |
T |
|
| Q |
101 |
tgcacatggttattcttg |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37275704 |
tgcacatggttattcttg |
37275721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University