View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10429_low_13 (Length: 302)
Name: NF10429_low_13
Description: NF10429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10429_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 293
Target Start/End: Original strand, 46519931 - 46520206
Alignment:
| Q |
18 |
atattattggactaatcataccaattcttcattgcatgctagggtttaagatcgtgagtgaacaattatggtttgccaatgatgaatttcgaatgagagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46519931 |
atattattggactaatcataccaattcctcattgcatgctagggtttatgatcgtgagtgaacaattatggtttgccaatgatgaatttcgaatgagagg |
46520030 |
T |
 |
| Q |
118 |
aaggagcggtgaccggtgagggacaagaactttgattatcctctaatgaaatttgaaggtgttgatgaagcaagaatttcgccgaggtttggtgaatatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46520031 |
aaggagcggtgaccggtgagggacaagaactttgattatcctctaatgaaatttgaaggtgttgatgaagcaagaattttgccgaggtttggtgaatatt |
46520130 |
T |
 |
| Q |
218 |
ttcaattgtatttttctttgcttcaagtgattgatgttgaggaatgaactctatccctcgactgtaggttctctgc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46520131 |
ttcaattgtatttttctttgcttcaagtgattgatgttgaggaatgaactctatccctcgactgtaggttctctgc |
46520206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University