View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10429_low_14 (Length: 290)
Name: NF10429_low_14
Description: NF10429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10429_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 66 - 202
Target Start/End: Original strand, 40915578 - 40915716
Alignment:
| Q |
66 |
agaagattgctatttaatccgagagatgttgtcctgaataaaagtctttttatgaacaaacccacctccctaaattgtc--tgtctactttattcaaaaa |
163 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40915578 |
agaacattgctatttaatccgagagatgttgtcctgaataaaagtctttttatgaacaaacccacctccctaaattgtctatgtctactttattcaaaaa |
40915677 |
T |
|
| Q |
164 |
attgtttttatagagacaacgctatatttttacagggac |
202 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40915678 |
attatttttatagagacaacgctatatttttacagggac |
40915716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University