View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10429_low_25 (Length: 213)

Name: NF10429_low_25
Description: NF10429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10429_low_25
NF10429_low_25
[»] chr1 (1 HSPs)
chr1 (20-179)||(47649660-47649819)
[»] scaffold0031 (1 HSPs)
scaffold0031 (20-164)||(91833-91977)
[»] scaffold0009 (1 HSPs)
scaffold0009 (20-67)||(171002-171049)
[»] chr5 (1 HSPs)
chr5 (20-94)||(30753873-30753947)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 179
Target Start/End: Complemental strand, 47649819 - 47649660
Alignment:
20 gaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtgattgtgaatattgcttttgaatcagttgtgggagagcgatcgg 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||| ||    
47649819 gaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtcattgcgaatattgcttttgaatcagttgtgggagggcgattgg 47649720  T
120 gatattgtcgtggcttaggagctggaattaaacccctaaagggaaagtctgtcacaggtt 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47649719 gatattgtcgtggcttaggagctggaattaaacccctaaagggaaagtctgtcacaggtt 47649660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 20 - 164
Target Start/End: Complemental strand, 91977 - 91833
Alignment:
20 gaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtgattgtgaatattgcttttgaatcagttgtgggagagcgatcgg 119  Q
    |||||| ||||||||  | || || |||||||||||||| |||||||||||||| | ||| |||||||||||||| ||||||||||||||||||||||||    
91977 gaagaagcttcttcatatcacctagaagctggatatgggaacactgataaagatttaattatgaatattgcttttaaatcagttgtgggagagcgatcgg 91878  T
120 gatattgtcgtggcttaggagctggaattaaacccctaaagggaa 164  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||    
91877 gatattgtcgtggcttgggagctggaattaaaaccctaaagggaa 91833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 67
Target Start/End: Original strand, 171002 - 171049
Alignment:
20 gaagaaacttcttcagtttacttacaagctggatatggggacactgat 67  Q
    ||||||||||||||||||| ||||||||||||||||| ||||||||||    
171002 gaagaaacttcttcagttttcttacaagctggatatgaggacactgat 171049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 30753947 - 30753873
Alignment:
20 gaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtgattgtgaatattgctttt 94  Q
    |||||| ||||||| | ||||| | || || ||||||||||||| |||||||||||||||  |||||||||||||    
30753947 gaagaagcttcttctgattactcagaaactagatatggggacaccgataaagatgtgattacgaatattgctttt 30753873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University