View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10429_low_27 (Length: 209)
Name: NF10429_low_27
Description: NF10429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10429_low_27 |
 |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 179
Target Start/End: Complemental strand, 47649819 - 47649660
Alignment:
| Q |
20 |
gaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtgattgtgaatattgcttttgaatcagttgtgggagagcgatcgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
47649819 |
gaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtcattgcgaatattgcttttgaatcagttgtgggagggcgattgg |
47649720 |
T |
 |
| Q |
120 |
gatattgtcgtggcttaggagctggaattaaacccctaaagggaaagtctgtcacaggtt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47649719 |
gatattgtcgtggcttaggagctggaattaaacccctaaagggaaagtctgtcacaggtt |
47649660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 20 - 164
Target Start/End: Complemental strand, 91977 - 91833
Alignment:
| Q |
20 |
gaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtgattgtgaatattgcttttgaatcagttgtgggagagcgatcgg |
119 |
Q |
| |
|
|||||| |||||||| | || || |||||||||||||| |||||||||||||| | ||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
91977 |
gaagaagcttcttcatatcacctagaagctggatatgggaacactgataaagatttaattatgaatattgcttttaaatcagttgtgggagagcgatcgg |
91878 |
T |
 |
| Q |
120 |
gatattgtcgtggcttaggagctggaattaaacccctaaagggaa |
164 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
91877 |
gatattgtcgtggcttgggagctggaattaaaaccctaaagggaa |
91833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 67
Target Start/End: Original strand, 171002 - 171049
Alignment:
| Q |
20 |
gaagaaacttcttcagtttacttacaagctggatatggggacactgat |
67 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
171002 |
gaagaaacttcttcagttttcttacaagctggatatgaggacactgat |
171049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 30753947 - 30753873
Alignment:
| Q |
20 |
gaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtgattgtgaatattgctttt |
94 |
Q |
| |
|
|||||| ||||||| | ||||| | || || ||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
30753947 |
gaagaagcttcttctgattactcagaaactagatatggggacaccgataaagatgtgattacgaatattgctttt |
30753873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University