View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10430_high_3 (Length: 342)
Name: NF10430_high_3
Description: NF10430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10430_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 20 - 334
Target Start/End: Original strand, 28911044 - 28911358
Alignment:
| Q |
20 |
ctctgtccacaattcacttaaaacttcatattgtgagttccactgatatcattgtcattagcctctgtcaaagctgctaaatcatacaaatacagtatcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28911044 |
ctctgtccacaattcacttaaaacttcatattgtgagttccactgatatcattgtcattagcctctgtcaaagctgctaaatcatacaaatacagtatcc |
28911143 |
T |
 |
| Q |
120 |
caaattcccaatggtcataaacaacgcattccagggtgattaattgttataacaagtcagtttttcaagcttaagctaataatttgtttaatcaaggttc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28911144 |
caaattcccaatggtcataaacaacgcattccagggtgattaactgttataacaagtcagtttttcaagcttaagctaataatttgtttaatcaaggttc |
28911243 |
T |
 |
| Q |
220 |
ctcggtactagtagatgcctcagaacgtcttctctttgcttcattatcacccagctgcagcgaaacacataaatcttcattacagtcattcctcaatgaa |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28911244 |
ctcggtactagtagatgcctcagaacgtcttctctttgcttcattatcacccagctgcaacgaaacacataaatcttcattacagtcattcctcaatgaa |
28911343 |
T |
 |
| Q |
320 |
gataaattctctgct |
334 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28911344 |
gataaattctctgct |
28911358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University