View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10430_low_14 (Length: 224)
Name: NF10430_low_14
Description: NF10430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10430_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 37434719 - 37434923
Alignment:
| Q |
1 |
tccaacggtgctttgtgattgaagcgaggtgaggacattgtcgcagtagattccttgcggtttgttaactacgagaagatattcatcttcgtaaatgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37434719 |
tccaacggtgctttgtgattgaagcgaggtgaggacattgtcgcagtagattccttgcggtttgttaactgcgagaagatattcatcttcgtaaatgatg |
37434818 |
T |
|
| Q |
101 |
tgggtttgtgccagagtgaagagttcggagtttgaagtagcgattgtggctctgttgagttcgatttgctttgagattgcgggaagttgaggtgagagtg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434819 |
tgggtttgtgccagagagaagagttcggagtttgaagtagcgattgtggctctgttgagttcgatttgctttgagattgcgggaagttgaggtgagagtg |
37434918 |
T |
|
| Q |
201 |
gtatt |
205 |
Q |
| |
|
||||| |
|
|
| T |
37434919 |
gtatt |
37434923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University