View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10430_low_3 (Length: 499)
Name: NF10430_low_3
Description: NF10430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10430_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 327; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 154 - 484
Target Start/End: Original strand, 44798760 - 44799090
Alignment:
| Q |
154 |
cgatggcattgcttttctcatttcatcaaccactgatttctcgtctctctctaatggttacatgggccttcctcattctgatcaagattcttactttgcg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798760 |
cgatggcattgcttttctcatttcatcaaccactgatttctcgtctctctctaatggttacatgggccttcctcattctgatcaagattcttactttgcg |
44798859 |
T |
|
| Q |
254 |
gttgaatttgatacaagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttcttttgcttctgctgatc |
353 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798860 |
gttgaatttgatacgagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttcttttgcttctgctgatc |
44798959 |
T |
|
| Q |
354 |
ttctttcacgtcggattgatttgaaaagtgggaaaatcatcaatgcatggattgagtatagagatgatatgaaaatggttcgtgtttgggttagttactc |
453 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798960 |
ttctttcacgtcggattgatttgaaaagtgggaaaatcatcaatgcatggattgagtatagagatgatatgaaaatggttcgtgtttgggttagttactc |
44799059 |
T |
|
| Q |
454 |
ttcaactagacctccaacaccaattattgct |
484 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44799060 |
ttcaactagacctccaacaccaattattgct |
44799090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 26 - 92
Target Start/End: Original strand, 44798632 - 44798698
Alignment:
| Q |
26 |
tctggaattggaagagctttctacctctatcctgttcgttttcttgatcctttaactaactcaaccg |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798632 |
tctggaattggaagagctttctacctctatcctgttcgttttcttgatcctttaactaactcaaccg |
44798698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University