View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10431_low_5 (Length: 229)
Name: NF10431_low_5
Description: NF10431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10431_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 8816519 - 8816733
Alignment:
| Q |
1 |
agagtgctggaaagcatttactatgcatcatatttatctattattacaaatcgaaacactaataaagccgttctggtatagagacttaggcacaattagt |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
8816519 |
agagtgctggaaagcattgactatgcatcatatttatctattattacaaatcgaaacactaataaagccgttctgatataga--cttaagcacaattagt |
8816616 |
T |
 |
| Q |
101 |
cgaaatctatggttatatgcttgtggctaagttacacaatagaatagtgttaagaatatataagtgcccgattgcactgccacattaattctaacattct |
200 |
Q |
| |
|
||||||||||| |||| | ||||||||||||||||||||||||||||||||||| | ||| ||||| ||| |||||| |||||||| |||||||||| || |
|
|
| T |
8816617 |
cgaaatctatgattatctacttgtggctaagttacacaatagaatagtgttaagtacatacaagtggccggttgcaccgccacatttattctaacatcct |
8816716 |
T |
 |
| Q |
201 |
tgcctcacctttgtttt |
217 |
Q |
| |
|
|| |||||| ||||||| |
|
|
| T |
8816717 |
tgtctcaccattgtttt |
8816733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University