View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10432_high_11 (Length: 231)
Name: NF10432_high_11
Description: NF10432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10432_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 11442012 - 11441816
Alignment:
| Q |
14 |
cagagacatattgttggtggtgattctgcagtggttggcaacatg--gcagcaaccaattctggtgttatgatggtggttggggcggcaatgatcaggac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
11442012 |
cagagacatattgttggtggtgattctgcagtggttggcaacctgtggcagcaaccaattctggtgttatgatggtggttggggcgacaatgatcaagac |
11441913 |
T |
 |
| Q |
112 |
aacggcggagacggcgcttgcggcttttatgaaggtgctggccaagagacgtgtacgcacagatgtgttgaaagcttgttcgtgtgggttcgtgcgg |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11441912 |
aacggcggagacggtgcttgcggcttttatgaaggtgctggccaagagacgtgtaaacacagatgtgttgaaagcttgttcgtgtgggttcgtgcgg |
11441816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 206
Target Start/End: Original strand, 47656385 - 47656579
Alignment:
| Q |
14 |
cagagacatattgttggtggtgattctgcagtggttggcaacatg--gcagcaaccaattctggtgttatgatggtggttggggcggcaatgatcaggac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
47656385 |
cagagacatattgttggtggtgattctgcagtggttggcaacctgtggcagcaaccaattctggtgttatgatggtggttggggcgacaatgatcaagac |
47656484 |
T |
 |
| Q |
112 |
aacggcggagacggcgcttgcggcttttatgaaggtgctggccaagagacgtgtacgcacagatgtgttgaaagcttgttcgtgtgggttcgtgc |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47656485 |
aacggcggagacggtgcttgcggcttttatgaaggtgctggtcaagagacgtgtaagcacagatgtgttgaaagcttgttcgtgtgggttcgtgc |
47656579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 54922834 - 54923016
Alignment:
| Q |
14 |
cagagacatattgttggtggtgattctgcagtggttggcaacatg--gcagcaaccaattctggtgttatgatggtggttggggcggcaatgatcaggac |
111 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||| ||||||||||| | |||||||||||||||||||| |||||| |
|
|
| T |
54922834 |
cagagacatattgttggtggtgactctacagtggttggcaacatgtggcagcaaccaactctggtgttatcacggtggttggggcggcaatgaccaggac |
54922933 |
T |
 |
| Q |
112 |
aacggcggagacggcgcttgcggcttttatgaaggtgctggccaagagacgtgtacgcacagatgtgttgaaagcttgttcgtg |
195 |
Q |
| |
|
||||||| |||||| ||||||| ||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
54922934 |
aacggcgaagacggtgcttgcgtcttttatgacggtgctagccaagagacgtgtacgcacagatgtgttg-aagcttgttcgtg |
54923016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 17 - 123
Target Start/End: Original strand, 50236408 - 50236516
Alignment:
| Q |
17 |
agacatattgttggtggtgattctgcagtggttggcaacatg--gcagcaaccaattctggtgttatgatggtggttggggcggcaatgatcaggacaac |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
50236408 |
agacaaattgttggtggtgattctgcagtggttggcaacatgtggcagcaaccaattctggtgttataatggtggtttgggcggcaatgaccaggacaac |
50236507 |
T |
 |
| Q |
115 |
ggcggagac |
123 |
Q |
| |
|
||||||||| |
|
|
| T |
50236508 |
ggcggagac |
50236516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University