View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10432_high_2 (Length: 323)
Name: NF10432_high_2
Description: NF10432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10432_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 7e-40; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 7908481 - 7908568
Alignment:
| Q |
1 |
atatgcaaatagcggaggatagagtgaaatgtctccaaaacattctgcaggtccgtttatctcaagtcatgaatcagtgagtatcaaa |
88 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7908481 |
atatgcaaatagcggaggatatagtgaaatgtctccaaaacattctgcaggtccgtttatctcaagtcatgaatcagtgagtatcaaa |
7908568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 175 - 261
Target Start/End: Complemental strand, 7352923 - 7352841
Alignment:
| Q |
175 |
attttgatgctattttttgtgtttaattagaaatcacagatagtttcttactcaaatggttgtaaatgaatggattacttagttgaa |
261 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7352923 |
attttgatgctattgtttgtgttca----gaaatcagagattgtttcttactcaaatggttgtaaatgaatggattagttagttgaa |
7352841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 248
Target Start/End: Complemental strand, 7332139 - 7332107
Alignment:
| Q |
216 |
agtttcttactcaaatggttgtaaatgaatgga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7332139 |
agtttcttactcaaatggttgtaaatgaatgga |
7332107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 261
Target Start/End: Complemental strand, 7291131 - 7291095
Alignment:
| Q |
226 |
tcaaatggtt-gtaaatgaatggattacttagttgaa |
261 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7291131 |
tcaaatggtttgtaaatgaatggattacttagttgaa |
7291095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University