View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10432_high_8 (Length: 249)
Name: NF10432_high_8
Description: NF10432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10432_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 3 - 240
Target Start/End: Original strand, 27560038 - 27560275
Alignment:
| Q |
3 |
gtagttatgtgaaatcagtcacttcctcccagtaacataagtagtgcaagaagtccatcagttatgtaatcaaagcaagaaaagtttaaaattttgtgta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
27560038 |
gtagttatgtgaaatcagtcacttcctcccagtaacataagtagtgcaagaagtccatcagttatgtaatcaaagcatgaaaagtttaaaatgttgtgta |
27560137 |
T |
|
| Q |
103 |
cacagcaaattaataaccgagtctcatatagacttcataactcaaatttggagttttttgttggtatgctaaattgctttgaccagacaaatatattgtt |
202 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27560138 |
cacagctaattaataactgagtctcatatagacttcataactcaaatttggagttttttattggtatgctaaattgctttgaccagacaaatatattgtt |
27560237 |
T |
|
| Q |
203 |
aatattgtcaagccaacgttctgttttgttatcctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27560238 |
aatattgtcaagccaacgttctgttttgttatcctatg |
27560275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University