View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10432_low_14 (Length: 239)
Name: NF10432_low_14
Description: NF10432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10432_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 2 - 223
Target Start/End: Complemental strand, 27559917 - 27559696
Alignment:
| Q |
2 |
caccaactgtggtcttcccttatctcaaatttcattatttaataatttgacaaaccaattcctagttgttaaacaacaatttgacaaaccaattttcgga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27559917 |
caccaactgtggtcttcccttatctcaaatttcattatttaataatttgacaaaccaattcctagttgttaaacaacaatttgacaaaccaattttctga |
27559818 |
T |
 |
| Q |
102 |
tatatgtgttttgagcttgtctgctgcaagaatgtgaaaattggcttagtggttgtaaagtctctttctaaagaggaaactgagttggcatgagttttta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27559817 |
tatatgtgttttgagcttgtctgctgcaagaatgtgaaaattggcttagtggttgtaaagtctctttctaaaggggaaactgagttggcatgagttttta |
27559718 |
T |
 |
| Q |
202 |
agtctgaagtaaccctttatat |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27559717 |
agtctgaagtaaccctttatat |
27559696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 223
Target Start/End: Complemental strand, 27556924 - 27556852
Alignment:
| Q |
151 |
tggttgtaaagtctctttctaaagaggaaactgagttggcatgagtttttaagtctgaagtaaccctttatat |
223 |
Q |
| |
|
|||||||||||||| ||||||||| |||| || |||||||||||||||| |||| |||||||| |||| |||| |
|
|
| T |
27556924 |
tggttgtaaagtctatttctaaaggggaatctaagttggcatgagttttgaagtgtgaagtaatccttgatat |
27556852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University