View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10432_low_7 (Length: 290)
Name: NF10432_low_7
Description: NF10432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10432_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 241
Target Start/End: Complemental strand, 44003634 - 44003405
Alignment:
| Q |
11 |
cacagaacaaaaaggacaaaggaaaatggtgaccgtgactgggggttcagaaaaataactgaccaacgtccacagcttcacatttttgtgtgggtcctac |
110 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44003634 |
cacaaaacaaaaaggacaaaggaaaaaggtgaccgtgactgggggttcagaaaaataactgaccaacgtccacagcttcacatttt-gtgtgggtcctac |
44003536 |
T |
 |
| Q |
111 |
taataatgggccacaaactacttcagctttaacttgttcttaacaaaaaccatttttatgaaagaaaataaatgaatctagtaaaatgtaagatctcttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44003535 |
taataatgggccacaaactacttcagctttaacttgttcttaacaaaaaccatttttatgaaagaaaataaatgaatctagtaaaatgtaagatctcttt |
44003436 |
T |
 |
| Q |
211 |
ttatatattaagtctcttttgatcttaataa |
241 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |
|
|
| T |
44003435 |
ttatatattaagtctcttcttatcttaataa |
44003405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 246 - 278
Target Start/End: Complemental strand, 51677723 - 51677691
Alignment:
| Q |
246 |
tgtgtatttggttcaactttggatataattgat |
278 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
51677723 |
tgtgtgtttggttcaactttggatataattgat |
51677691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University