View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10434_high_12 (Length: 241)
Name: NF10434_high_12
Description: NF10434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10434_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 38508315 - 38508110
Alignment:
| Q |
18 |
ataagtgtgtatgtgaatactttacttaccataggttgtgtagacaattgtgcaagaaagcagtgtgtgtggacgataatttttggaaaaaataattaaa |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
38508315 |
ataagtgtgtatgtgaatactt-----accataggttgtgtagacaattgtgcaagaaagc----------gactataatttttggaaaaaataattaaa |
38508231 |
T |
 |
| Q |
118 |
tatgatttgatgatatatatttgcattgcaatacttcaaatggaaggttgtggtgttgttccttcacgagtaaccaatcattaatactttgatctcaagc |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38508230 |
tatgatttgatgatatatatttgtattgcaatacttcaaatggaaggttgtggtgttgttccttcacgagtaaccaatcatgaatactttgatctcaagc |
38508131 |
T |
 |
| Q |
218 |
agtctattgccaaggatcaaa |
238 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
38508130 |
agtctattttcaaggatcaaa |
38508110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University