View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10434_low_16 (Length: 245)
Name: NF10434_low_16
Description: NF10434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10434_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 72 - 229
Target Start/End: Complemental strand, 35443146 - 35442988
Alignment:
| Q |
72 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttt-gattagtaaatagtagatagg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35443146 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
35443047 |
T |
 |
| Q |
171 |
gtttgtttggttacaaaatgctaaaaatacatatatttatgtaaaataagtggttaaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35443046 |
gtttgtttggttacaaaatgctaaaaatacatatatttatttaaaataagtggttaaat |
35442988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 35443279 - 35443205
Alignment:
| Q |
1 |
ttgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctt-ttttatgtttgt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35443279 |
ttgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctttttttatgtttgt |
35443205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 195 - 224
Target Start/End: Original strand, 16780329 - 16780358
Alignment:
| Q |
195 |
aaatacatatatttatgtaaaataagtggt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16780329 |
aaatacatatatttatgtaaaataagtggt |
16780358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University