View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10434_low_19 (Length: 221)
Name: NF10434_low_19
Description: NF10434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10434_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 50214558 - 50214358
Alignment:
| Q |
15 |
aaaggtaaaattgaagtgcgggtttgttatattaagtgaccatgaataatatatatctctgatataatacttgttgcaacaatggagttttagaagagag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50214558 |
aaaggtaaaattgaagtgcgggtttgttatattaagtgaccatgaataatatatatctctgatataatacttgttgcaacaatggagttttagaagagag |
50214459 |
T |
|
| Q |
115 |
aattgaaattgaatgctctgaaattgatatacgatgtgtagcaaagcatatagaactagcccttatgtaaattgttactagacttgatgtccatctcatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||| ||| |
|
|
| T |
50214458 |
aattgaaattgaatgctctgaaattgatatacgatgtgtagcaaagcatattgaactagcccttatgtaaattgttactagacttgctgtctatctaatt |
50214359 |
T |
|
| Q |
215 |
g |
215 |
Q |
| |
|
| |
|
|
| T |
50214358 |
g |
50214358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University