View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10434_low_20 (Length: 218)
Name: NF10434_low_20
Description: NF10434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10434_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 27033716 - 27033907
Alignment:
| Q |
16 |
atcattaagagcagtgttatatattaagaatgaatttatcacgacactttctcgaaaagcattttggccaatcacaagttt-ggctggcacagaaatcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27033716 |
atcattaagagcagtgttatatatcaagaatgaatttatcacgacactttctcgaaaagcattttggccaatcacaagttttggctggcacagaaatcaa |
27033815 |
T |
 |
| Q |
115 |
gatatgtgaaatctcatgaacgttgatttaggagataactcgcttgaaggaagagtccccttaccactatttagacttcaaatcctttgctt |
206 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27033816 |
gatatgtgaaatctcatgaacattgatttaggagataactcgcttgaaggaagagtcccctcaccactatttagacttcaaatcctttgctt |
27033907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University