View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10434_low_3 (Length: 637)
Name: NF10434_low_3
Description: NF10434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10434_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 368
Target Start/End: Complemental strand, 44495549 - 44495207
Alignment:
| Q |
20 |
gaagttttctttgaaagtgattttaagcaaaatgaatgagattgatggtatggtgtatgggttatattttatcactcactctgacaatggaagaataaga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
44495549 |
gaagttttctttgaaagtgattttaagcaaaatgaatgagattgatggtatggtgtatgggttatattttatcactc----tggcaatggaagaataagg |
44495454 |
T |
|
| Q |
120 |
aggttcacgttgaaggtgttttgctcagcagtatgtcaactaatatcaaataaaaggaatatggaatgagcagtgctatatgtcgcgaccaaaggttcac |
219 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
44495453 |
aggctcacgttgaaggtgttttgctcagcagtatgtcaactaatatcaaataaaaggaatatggaatgagcagtgctatatgtcgcaaccaaaggttctc |
44495354 |
T |
|
| Q |
220 |
gaattgttaaatctttatatttcttcacactaacagt----atcagcggtgctactctgagtgtatagctaactaac-ttcaccacctctttcctcatac |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||| | ||||||||||||| |
|
|
| T |
44495353 |
gaattgttaaatctttatatttcttcacactaacagtatcaatcagcggtgctactctgtct-------caactaacatggtgtgattctttcctcatac |
44495261 |
T |
|
| Q |
315 |
aacttaaccaattttttattttctccttcatgattttatctaaaacacttatat |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44495260 |
aacttaaccaattttttattttctccttcatgattttatctaaaacacttatat |
44495207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University