View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10434_low_6 (Length: 424)
Name: NF10434_low_6
Description: NF10434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10434_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 158 - 412
Target Start/End: Complemental strand, 39492040 - 39491793
Alignment:
| Q |
158 |
catgaaaatttcaaatgtctgcaaagttacgttttctatcaaaccttcgatgatcttcctgagctacaaacttattcaatatgaattcagatttcagaat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39492040 |
catgaaaatttcaaatgtctgcaaagttgcgttttctatcaaaccttcgatgatcttcctgagctacaaacttattcaatatgaattcaga-------at |
39491948 |
T |
|
| Q |
258 |
caccctttacttcagaattggtgtcaccaactagaggtgtgataagaacagttgtacttgttaaagaattcttagatcattcttaacaatatcattgtac |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39491947 |
caccctttacttcagaattggtgtcaccaactggaggtgtgataagaacagttgtacttgttaaagaatgcttagatcattcttaacaatatcattgtac |
39491848 |
T |
|
| Q |
358 |
ttgtgattcttatctccaccttcaatttgaagctcaacaattacctctttgtctg |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39491847 |
ttgtgattcttatctccaccttcaatttgaagctcaacaattacctctttgtctg |
39491793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 59 - 120
Target Start/End: Complemental strand, 39492104 - 39492041
Alignment:
| Q |
59 |
ttattttttgagcgcaataataagttaaacaaac--atgcacgctagtattattcatagaaaat |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39492104 |
ttattttttaagcgcaataataagttaaacaaacatatgcacgctagtattattcatagaaaat |
39492041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 93 - 155
Target Start/End: Original strand, 39287199 - 39287261
Alignment:
| Q |
93 |
atgcacgctagtattattcatagaaaataaaaatataaaatcatggggggacaataaccaaaa |
155 |
Q |
| |
|
||||||||||| |||||| || ||||| | |||||||||||||| |||| |||| |||||||| |
|
|
| T |
39287199 |
atgcacgctagcattattaatcgaaaagataaatataaaatcattggggcacaagaaccaaaa |
39287261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University