View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10435_low_8 (Length: 225)
Name: NF10435_low_8
Description: NF10435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10435_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 38619214 - 38619013
Alignment:
| Q |
17 |
agataagaatgggaaataagacattaatcaactgttgcaagtaattaatggaacgtaagtgttgcttnnnnnnncaaagtttagctagttaatttgacat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38619214 |
agataagaatgggaaataagacattaatcaactgttgcaagtaattaatggaacgtaagtgttgcttaaaaaaacaaagtttagctagttaatttgacat |
38619115 |
T |
|
| Q |
117 |
ttcagccattattataaattta---------ttagtgcaattaaaatttattgataaaacgtcgttttcttactttcct-ccccccaccttcaatacacg |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38619114 |
ttcagccattattataaatttattagtgcttttagtgcaattaaaatttattgataaaacgtcgttttcttactttcctcccccccaccttcaatacacg |
38619015 |
T |
|
| Q |
207 |
gt |
208 |
Q |
| |
|
|| |
|
|
| T |
38619014 |
gt |
38619013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University