View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10436_high_14 (Length: 254)
Name: NF10436_high_14
Description: NF10436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10436_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 46669870 - 46669645
Alignment:
| Q |
19 |
ggtatttggtggggattgtgaattaaggatttataaagagaggtagatcgatttttccacaatggtatatgtgtgtgtgggttcaaatataaatatacgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46669870 |
ggtatttggtggggattgtgaattaaggatttataaagagaggtagatcgatttttccacaatggtatatgtgtgtgtgggttcaaatataaatatacgt |
46669771 |
T |
|
| Q |
119 |
ctcattcatcttttatcacaaaccaataatgtttagggtcaaatagtatagactatagaggaatatcaaatcacatcatgtggggtggtgtcgcacaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46669770 |
ctcattcatcttttatcacaaaccaataatgtttagggtcaaatagtatagactatagaggaatatcaaatcacatcatgtggggtggtgtcgcacaatt |
46669671 |
T |
|
| Q |
219 |
gctgtcttaaaataatggttcctttg |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46669670 |
gctgtcttaaaataatggttcctttg |
46669645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University