View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10436_high_22 (Length: 210)
Name: NF10436_high_22
Description: NF10436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10436_high_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 9551461 - 9551311
Alignment:
| Q |
1 |
tagtttttgttgttcctcacaaccataacaacatcttttggtgtgttaaattcaacaatcatgaaaatagaactcaccaaaaggaaagaggtgttcatga |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9551461 |
tagtttttgttgttcatcacaaccataacaacatcttttggtgtgttaaagtcaacaatcatgaaaatagaaatcaccaaaaggaaagaggtgttcatga |
9551362 |
T |
|
| Q |
101 |
acaaagtatatttggaccaagaagttggtatagccatagtgtttgtggggg |
151 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
9551361 |
acaaagtatatttggaccaagaacttggtatagccatggtgtttgtggggg |
9551311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University