View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10436_high_4 (Length: 490)
Name: NF10436_high_4
Description: NF10436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10436_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 4e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 18 - 165
Target Start/End: Complemental strand, 2571832 - 2571685
Alignment:
| Q |
18 |
ctatgaacactttttctagttttcttgctacttttaagttttgctttatggagaattttccatagttatatggatctgatggtgatgaacgaattgcgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2571832 |
ctatgaacactttttctagttttcttgctacttttaggttttgctttatggagaattttccatagttatatggatctgatggtgatgaacgaattgcgga |
2571733 |
T |
 |
| Q |
118 |
tagcatcgagcgacatagtttcggatacaatgtcgttttgcacgcggc |
165 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2571732 |
tagcattgagcgacatagtttcggatacaatgtcgttttgcacgcggc |
2571685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 242 - 400
Target Start/End: Complemental strand, 2571608 - 2571450
Alignment:
| Q |
242 |
atgaaaaggagaagggaaagtgaaggtgacatgnnnnnnnggaagtataatgaaaggtggtttgagtatgtgttattttgcttgtgggatgtgtttagga |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2571608 |
atgaaaaggagaagggaaagtgaaggtgacatgtttttttggaagtttaatgaaaggtggtttgagtatgtgttattttgcttgtgggatgtgtttagga |
2571509 |
T |
 |
| Q |
342 |
ataatggtagtactaggaatttataggcacatagacgaagttgttgagataaataaata |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2571508 |
ataatggtagtactaggaatttataggcacatagacgaagttgttgagataaataaata |
2571450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 404 - 461
Target Start/End: Complemental strand, 2571256 - 2571199
Alignment:
| Q |
404 |
cctatctctaaatagtttatttggaaaataacattgtcactcttcaatgtgttattaa |
461 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
2571256 |
cctatctctaaatagtttatttgaaaaataacattgtcagtcttcaatgtgttattaa |
2571199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University