View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10436_low_22 (Length: 242)
Name: NF10436_low_22
Description: NF10436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10436_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 32373671 - 32373440
Alignment:
| Q |
1 |
aggcattgatatctttattctctgatgccactaatgtaacacgagcgaattacgcgtatctcattgattgcgcattcggttgtttcttagcgaaaaacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373671 |
aggcattgatatctttattctctgatgccactaatgtaacacgaacgaattacgcgtatctcattgattgcgcattcggttgtttcttagcgaaaaacag |
32373572 |
T |
 |
| Q |
101 |
tccaatagagaagaaaaagaagatattagatcttttagccgattcgacaaacttgttagttcaatggcagagaacacaatatacagatccaggtagtaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373571 |
tccaatagagaagaaaaagaagatattagatcttttagccgattcgacaaacttgttggttcaatggcagagaacacaatatacagatccaggtagtaat |
32373472 |
T |
 |
| Q |
201 |
gtcagtgtagtaagcaacacaagtagttcatc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32373471 |
gtcagtgtagtaagcaacacaagtagttcatc |
32373440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University