View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10436_low_24 (Length: 232)
Name: NF10436_low_24
Description: NF10436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10436_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 40073073 - 40073282
Alignment:
| Q |
1 |
gttttaaggagaaggcattcagagaaggtgagtgtttggtatggtgaaatgagagagccttatttgaaatggagtgaaaggaggccgtttgttaagcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40073073 |
gttttaaggagaaggcattcagagaaggtgagtgtttggtatggtgaaatgagagagccttatttgaaatggagtgaaaggaggccgtttgttaagcatt |
40073172 |
T |
 |
| Q |
101 |
ttacggggtgtcagccatgtagtggggatcataaccctagttataagggtgatgtttgttggaaagagatggagagggctttgaattttgctgataatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40073173 |
ttacggggtgtcagccatgtagtggggatcataaccctagttataagggtgatgtttgttggaaagagatggagagggctttgaattttgctgataatca |
40073272 |
T |
 |
| Q |
201 |
agtgcttcgt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
40073273 |
agtgcttcgt |
40073282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 207
Target Start/End: Complemental strand, 13713897 - 13713859
Alignment:
| Q |
169 |
atggagagggctttgaattttgctgataatcaagtgctt |
207 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
13713897 |
atggagagggcttttaattttgcagataatcaagtgctt |
13713859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University