View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10436_low_27 (Length: 207)
Name: NF10436_low_27
Description: NF10436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10436_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 24265893 - 24265722
Alignment:
| Q |
17 |
tgaatcaatgttagcaatgattgtaccctcaccatatcttgccttctcccatatggagtctttgggaaccactccataattgttctctagcccaagaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24265893 |
tgaatcaatgttagcaatgattgtaccctcaccatatcttcccttctcccatatggagtctttgggaaccactccataattgttctctagcccaagaaat |
24265794 |
T |
|
| Q |
117 |
tcccatgatcttgtggtttgcaattcatgccctttgttctcaaacacagacactacatttggatgttctgca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24265793 |
tcccatgatcttgtggtttgcaattcatgccctttgttctcaaacacagacactacatttggatgttctgca |
24265722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 42309583 - 42309426
Alignment:
| Q |
20 |
atcaatgttagcaatgattgtaccctcaccatatcttgccttctcccatatggagtctttgggaaccactccataattgttctctagcccaagaaattcc |
119 |
Q |
| |
|
||||| |||| |||||||||| | ||||||||||||||||||||||| ||||| || || |||| | | ||| || || |||| |||||||||||| |
|
|
| T |
42309583 |
atcaaggttaccaatgattgtgtcttcaccatatcttgccttctcccaaatggattccttaggaattatttcat--ttctt-tctactccaagaaattcc |
42309487 |
T |
|
| Q |
120 |
catgatcttgtggtttgcaattcatgccctttgttctcaaacacagacactacatttggat |
180 |
Q |
| |
|
||||| ||||| || ||||||| |||| ||||||| | | ||||||||||||||||||| |
|
|
| T |
42309486 |
catgaccttgttgtatgcaattgatgcattttgttcaaagatacagacactacatttggat |
42309426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University