View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_high_15 (Length: 204)
Name: NF10437_1D_high_15
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 5 - 154
Target Start/End: Original strand, 43586091 - 43586236
Alignment:
| Q |
5 |
ggtgttcatgtatgtgtctgtgcttcatagaaaaggacccttttctataatttacaaatcaatcaatgaaatcattcaatatttcttctatctatgtaat |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43586091 |
ggtgtccatgtatgtgtctgtgcttcatagaaaatgacccttttctatcatttacaaatcaatcaatgaaatcattcaatatttcttctatc----taat |
43586186 |
T |
|
| Q |
105 |
atgtaatatttcctgtagataaattttgagaaagtgtgaaaacataaaag |
154 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43586187 |
atgtactattttctgtagataaattttgagaaagtgtgaaaacataaaag |
43586236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 142 - 181
Target Start/End: Original strand, 43586239 - 43586278
Alignment:
| Q |
142 |
gaaaacataaaagagaaagaaatgtgataaacaatgttac |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43586239 |
gaaaacataaaagagaaagaaatgtgataaacaatgttac |
43586278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University