View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_18 (Length: 286)
Name: NF10437_1D_low_18
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 43 - 261
Target Start/End: Original strand, 39996947 - 39997165
Alignment:
| Q |
43 |
cacaccatgttggttccattggtctcacatagtaacagcttttgaatgctactgatgttgatgttgaagatggcatgttttagaacacaaagattgtctc |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39996947 |
cacaccatgttggttccattggtctcacatagtaacagcctttgaatgctactgatgttgatgttgaagatggcatgttttagaacacaaagattgtctc |
39997046 |
T |
|
| Q |
143 |
accctctttttgacgttccaccccaaaaaagtgatgacttgtttgctttatttaatgttgctctcacaagtgttttctaaattcagtttgtgagataaaa |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39997047 |
accctctttttgacgttccaccccaaaaaagtgatgacttgtttgctttatttaatgttgctctcacaagtgttttctaaattcagtttgtgagattaaa |
39997146 |
T |
|
| Q |
243 |
agttcattagagaaatctt |
261 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39997147 |
agttcattagagaaatctt |
39997165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 95
Target Start/End: Complemental strand, 53036645 - 53036596
Alignment:
| Q |
46 |
accatgttggttccattggtctcacatagtaacagcttttgaatgctact |
95 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||| |||| |||| |
|
|
| T |
53036645 |
accatgttggttccattggtctcacagagtaacaacttttcaatgttact |
53036596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University